자유게시판

Washed three times with PBS. Then 15 000 cells/sample were analyzed on a FACSCaliburTM flow cytometer (Becton Dickinson) using the following settings: forward scatter (FSC): E00 voltage, 1.14 amp gain, linear mode, threshold 180; side scatter (SSC): 434 voltage, 1.00 amp gain, linear mode; and fluorescence on log mode. The percentage of cells that were positive for A647-CD14 or GFP was measured on quadrant dotplots.Flow cytometric assessment of cell deathTotal RNA was isolated with the RNeasy mini kit (Qiagen), using RNase-Free DNase, according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using Superscript III first strand reverse transcriptase kit (Life Technologies) according to theTo determine if EHV-1 induced cell death, we 3-Amino-1H-indazole-4-carbonitrile infected cells PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/744568 for 4 or 24 h with all EHV-1 strains at an MOI PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/21715270 of 1 and 5 and then measured changes in mitochondrial transmembrane potential (m) by staining with a fluorescent cationic dye and monitoring changes in fluorescence with flow cytometry, according to the manufacturer's protocol (DePsipherTM kit, Trevigen Inc.). For analysis, monocytes were gated based on their FSC and SSC characteristics. In healthy cells with a high negative m, the lipophilic cationic dye accumulates in the mitochondrial matrix as a multimer and fluoresces bright red (FL2 channel). Red fluorescence is lost when the cells have altered mitochondrial membrane permeability, an early marker of apoptosis [38]. Since changes in mYeo et al. Veterinary Research 2013, 44:16 http://www.veterinaryresearch.org/content/44/1/Page 4 ofTable 1 Primers used for measurement of equine TF mRNA by quantitative real-time PCRGene Equus caballus TF forward Equus caballus TF reverse Equus caballus 2-microglobulin forward Equus caballus 2-microglobulin reverse Length (bp) 23 21 22 25 Amplicon size 243 243 209 209 Sequence (5' ?3') 5' - GTGGCTAGAGCCGCAGGGACTAG 5' - AGGAAGAGACCCGCGCCATGT 5' - TGTCTCTGGGTTCCATCCGCCT 5' - CGGACCCACTTAACTATCAGGGGGTare potentially reversible [39], we also performed a live-dead assay by staining for Annexin V and measuring propidium iodide uptake (TACSW Annexin V-FITC kit, Trevigen Inc), according to the manufacturer's protocol. This was done on monocyte-enriched fractions infected with RacL11 at an MOI of 1 or 5 for 4 or 24 h. Cells treated with LPS (10 ng/mL or 10 g/mL) and sodium azide (25 mM, Sigma-Aldrich) served as positive treatment and cell death controls, respectively, whereas vehicle- (PBS) treated cells were used as a negative control for all cell death experiments.Statistical analysisData were parametric and results are expressed as mean ?SD values. Comparison between multiple means was performed with a 1-way ANOVA followed by a Tukey's Multiple Comparison Test. Comparison of two means was performed with a paired t-test (Prism 5.0 for Mac OS, version 5.0c, GraphPad Software Inc). Significance was set at p < 0.05.ResultsEHV-1 infection of monocytes and induction of procoagulant activityTo verify that monocytes were infected with EHV-1 in vitro, flow cytometric analysis with the GFP-expressing variants RacL11N752 and Ab4D752 was done. A monocyte purity of 81 ?7 (range 65-88 , 3-Nitro-6-(trifluoromethyl)pyridin-2(1H)-one n = 10) was obtained in the monocyte-enriched fraction with the anti-equine CD14-based immunopurification technique, as assessed by differential leukocyte counts on cytospin preparations of the fraction. Flow cytometric analysis was performed 24 h after infection of monocyte-enriched and -depleted fractions to allow time for.